Available sequence file formats

BACK
FASTA format
Example of FASTA format
>pGT875
ATGCCTATGATACTGGGATACTGGAACGTCCGCGGACTGACACACCCGATCCGCATGCTC
CTGGAATACACAGACTCAAGCTATGATGAGAAGAGATACACCATGGGTGACGCTCCCGAC
TTTGACAGAAGCCAGTGGCTGAATGAGAAGTTCAAGCTGGGCCTGGACTTTCCCAATCTG
CCTTACTTGATCGATGGATCACACAAGATCACCCAGAGCAATGCCATCCTGCGCTACCTT
GCCCGAAAGCACCACCTGGATGGAGAGACAGAGGAGGAGAGGATCCGTGCAGACATTGTG
GAGAACCAGGTCATGGACACCCGCATGCAGCTCATCATGCTCTGTTACAACCCTGACTTT
GAGAAGCAGAAGCCAGAGTTCTTGAAGACCATCCCTGAGAAAATGAAGCTCTACTCTGAG
TTCCTGGGCAAGAGGCCATGGTTTGCAGGGGACAAGGTCACCTATGTGGATTTCCTTGCT
TATGACATTCTTGACCAGTACCGTATGTTTGAGCCCAAGTGCCTGGACGCCTTCCCAAAC
CTGAGGGACTTCCTGGCCCGCTTCGAGGGCCTCAAGAAGATCTCTGCCTACATGAAGAGT
AGCCGCTACATCGCAACACCTATATTTTCAAAGATGGCCCACTGGAGTAACAAGTAG